Содержание

AD/LDAP интеграция. Настройки модуля

Недоступно в редакциях: Бизнес, Малый бизнес, Стандарт, Старт

Закладки

Форма настроек модуля AD/LDAP интеграция (Настройки > Настройки продукта > Настройки модулей > AD/LDAP интеграция) предназначена для задания общесистемных параметров модуля.


Настройки

Закладка предназначена для настройки общих параметров модуля.

Поле Описание
E-mail для пользователей, у которых он не указан Задается e-mail для пользователей, не указавших его, например, [email protected].
Использовать NTLM авторизацию При отмеченной опции будет использоваться NTML авторизация. Для работы NTLM авторизации требуется выполнить настройку соответствующих модулей веб-сервера, а также задать домены для NTLM авторизации в настройках AD-серверов на портале.
Текущий логин пользователя NTLM авторизации (домен\логин) Выводится автоматически определяемый текщий логин пользователя NTML авторизации.
Имя переменной PHP, в которой хранится логин пользователя NTLM (обычно REMOTE_USER) Указывается название переменной PHP, в которой будет храниться логин пользователя, использующего NTML авторизацию.
Сервер домена по умолчанию Указывается сервер домена, который будет использоваться по умолчанию для NTML авторизации.
Создавать новых пользователей при первой успешной авторизации Указывается, создавать или нет новых пользователей при первой успешной авторизации. Работает и для NTML авторизации.
Проверять авторизацию на всех доступных ldap серверах, если в логине не указан префикс При отмеченной опции будет производиться попытка авторизации на всех доступных ldap-серверах, если указан логин без префикса.
Создавать пользователя, если пользователь с таким логином уже существует Указывается, будет ли создаваться второй пользователь, если при импорте обнаруживается пользователь с таким логином.
Переадресация Ntlm авторизации на порты 8890 8891
Включить переадресацию NTLM авторизации При отмеченной опции будет включена переадресация NTLM авторизации на 8890 и 8891 порты.
Ограничить NTLM переадресацию следующей подсетью Указывается подсеть, NTLM авторизацию пользователей которой, необходимо переадресовывать.

Например: 192.168.1.0/24 или 192.168.1.0/255.255.255.0.
Можно указать несколько диапазонов через точку с запятой (;).
Если поле оставить пустым, тогда переадресация будет работать для всех пользователей.

Доступ

Закладка позволяет настроить права на доступ к модулю для всех имеющихся в системе групп пользователей.

Поле Описание
По умолчанию Уровень доступа групп пользователей, для которых установлено право «по умолчанию».
[группа_пользователей] Изменение настроек доступа для конкретной группы. Возможно назначение следующих прав доступа к модулю AD/LDAP интеграция:
  • [D] закрыт — запрет на доступ;
  • [R] просмотр всех данных модуля — разрешается только просмотр всех данных модуля;
  • [W] запись — полный доступ к ресурсам модуля.
Добавить право доступа Ссылка, позволяющая добавить дополнительное право доступа для группы пользователей.

© «Битрикс», 2001-2021, «1С-Битрикс», 2021

Наверх

Акции NTML — цена и графики (TASE:NTML) — TradingView

Оценка стоимости

Стоимость компании/EBITDA, ТТМ —

Стоимость компании, фин.квартал —

Рын. кап. — Базовая —

Количество сотрудников —

Количество акционеров —

Цена/прибыль, ТТМ —

Цена/выручка, ТТМ —

Цена/Баланс. стоимость, FY —

Цена/Объём продаж, FY —

Бухгалтерский баланс

Коэфф. текущей ликвидности, FQ —

Задолженность/Капитал, FQ —

Чистая задолженность, FQ —

Коэфф. быстрой ликвидности, FQ —

Итого активы, FQ —

Итого задолженность, FQ —

Операционные показатели

Прибыль на общ. сумму активов, TTM —

Доход на капитал, ТТМ —

Прибыль на инвестиции, ТТМ —

Выручка на одного работника, ТТМ —

Динамика цен

Средний объём (10 дн.) —

Бета — 1 год —

Цена — 52 недель макс. —

Цена — 52 недель мин. —

Дивиденды

Выплачено дивидендов, FY —

Дивиденды на акцию, FY —

Ожидаемые годовые дивиденды —

Дивидендный доход —

Рентабельность

Чистая рентабельность, ТТМ —

Валовая рентабельность, ТТМ —

Операционная рентабельность, ТТМ —

Доналоговая рентабельность, ТТМ —

Отчет о доходах

Базовая приб./акцию, чистый доход —

Баз. прибыль на акцию, ТТМ —

EBITDA, ТТМ —

Валовая прибыль, FY —

Прибыль/акцию за посл. год —

Годовая выручка, FY —

Чистый доход, FY —

Общая выручка, FY —

Движение своб. денежных средств, ТТМ —

що таке NTML — код сторінки ​

помогите умоляю вас!!​

помогите пожалуйста!!!!!!!!!!!!​

Заповніть таблицю прикладами даних різних видів для наведених комп’ютерних програм.пожаалуйста очень срочно надо​

Поясніть процес створенння та публікації веб-ресурсів.

Срочно! 20 балов! Python Давайте напишем программу, которая будет рисовать три треугольника разных размеров. Размер треугольника программа будет спраш … ивать у пользователя. Но если треугольник будет слишком большим, то красивым рисунок точно не получится. А если размер треугольника будет меньше нуля, то его форма тоже может пострадать. Поэтому программа будет проверять, если длина больше 0 и меньше 100, то она нарисует треугольник. Иначе черепашка выведет сообщение “ошибка” с помощью команды t.write().

Дан код программы: n = 4 summa = 20 i = 1 while i<=n: summa = summa — i i = i + 1 print(summa) Какой результат будет выведен на экран?

Дан код программы: n = 5 summa = 14 for i in range (n): summa = summa — i print(summa) Какой результат будет выведен на экран?

В ячейку C2 записали формулу: Затем эту формулу скопировали из ячейки C2 в ячейку C3. Какой вид приобрела эта формула? =A2+B3*B1 =A3+B4*B2 =A3+B3*B1 = … A2+B4*B2 пж очень срочно!! даю 25 баллов

На флешке свободно 32 мегабайта.На неё записали папку «Музыка» с двумя файлами (10 и 4 мегабайт)и «Документы» с двумя файлами (2048 и 4096 килобайт).С … колько свободного места осталось на флешке? Подсказка: папка не имеет веса (0 байт). Иммерсивное средство чтения (Баллов: 10) Не хватит места 86 килобайт 12 мегабайта 90 килобайт

На флешке свободно 32 мегабайта.На неё записали папку «Музыка» с двумя файлами (10 и 4 мегабайт)и «Документы» с двумя файлами (2048 и 4096 килобайт).С … колько свободного места осталось на флешке? Подсказка: папка не имеет веса (0 байт). Иммерсивное средство чтения (Баллов: 10) Не хватит места 86 килобайт 12 мегабайта 90 килобайт

Как Сделать Запрос Ntml С Помощью Alamofire 4.0?

Я не знаю, насколько это уместно для вас, но у меня есть рабочее решение, которое я опубликую для любой будущей ссылки.

Итак, у меня было два вопроса. Первый заключается в том, что заголовок авторизации упал на запрос при его перенаправлении. Второй — вызов NTLM с сервера, который не обрабатывается. Следующий код должен быть вполне объяснительным, я надеюсь 🙂 Это означает, что вы храните имя пользователя и пароль в имени переменных именно этого.

    let credentialData = "\(username):\(password)".data(using: String.Encoding.utf8)!
let base64Credentials = credentialData.base64EncodedString(options: [])
request.addValue("Basic \(base64Credentials)", forHTTPHeaderField: "Authorization")

let manager = Alamofire.SessionManager.default
let delegate: Alamofire.SessionDelegate = manager.delegate

// This bit will re-add the auth headers for the redirected request
delegate.taskWillPerformHTTPRedirection = { session, task, response, request in
var redirectedRequest = request

if let originalRequest = task.originalRequest, let redirectheaders = originalRequest.allHTTPHeaderFields {
if let authorizationHeaderValue = redirectheaders["Authorization"] {
redirectedRequest.setValue(authorizationHeaderValue, forHTTPHeaderField: "Authorization")
}
if let contentTypeHeaderValue = redirectheaders["Content-Type"] {
redirectedRequest.setValue(contentTypeHeaderValue, forHTTPHeaderField: "Content-Type")
}
}

return redirectedRequest
}

// This bit looks at challenges received and applies the correct credentials
delegate.taskDidReceiveChallenge = { session, task, challenge in
var disposition: URLSession.AuthChallengeDisposition = .useCredential
var credential: URLCredential = URLCredential()

if (challenge.protectionSpace.authenticationMethod == NSURLAuthenticationMethodNTLM) {
disposition = URLSession.AuthChallengeDisposition.useCredential
credential = URLCredential(user: username, password: password, persistence: URLCredential.Persistence.forSession)
}

if (challenge.protectionSpace.authenticationMethod == NSURLAuthenticationMethodServerTrust) {
disposition = URLSession.AuthChallengeDisposition.useCredential
credential = URLCredential(trust: challenge.protectionSpace.serverTrust!)
}

return(disposition, credential)
}

manager.request(request).responseData { (response) in
// Handle response accordingly
}

Надеюсь, это поможет кому-то.

Экранная матрица NTML

Скрининговая матрица библиотеки транспозонов-мутантов Небраски (NTML) для скрининга фенотипов состоит из 1920 транспозонов (Tn) мутанты коллекции NTML размещены в пяти 384-луночных микротитрационных планшетах. Он предназначен для использования в качестве ресурса для выполнения высокопроизводительный фенотипический скрининг для выявления генов-кандидатов для будущих исследований. Каждая лунка содержит 150 мкл одного мутант транспозона, замороженный в 25% глицерине.В отличие от коллекции NARSA, у этих мутантных штаммов не было вставки Tn. сайт повторно секвенировали для подтверждения идентичности каждой мутации. Вторичные мутации сайта могли произойти во время поколения библиотеки; поэтому мы рекомендуем, чтобы пользователи массива подтверждали каждый мутант, выбранный на экране, и чтобы пользователи также передавали мутация в свежий фон посредством бактериофаг-опосредованной трансдукции. Наконец, чтобы гарантировать качество этого ресурса для исследовательского сообщества и для уменьшения количества переходов от пользователя к пользователю, мы просим не воспроизводить эту библиотеку и распространяться среди других исследователей любым способом (как в целом, так и в виде отдельных изолятов), поскольку эти мутантные штаммы могут быть получены бесплатно через NARSA, посетив этот веб-сайт NTML и разместив свой заказ.Пожалуйста, скачайте Справочный документ «NTML 384-луночная матрица для идентификации лунок», содержащий список мутантных штаммов в каждой лунке NTML-скрининговой матрицы.

Ценный набор генетических инструментов, разработанный CSR в UNMC для повышения полезности NTML, теперь доступен в NARSA

Ниже представлена ​​важная информация о генетическом наборе инструментов для повышения полезности NTML. В этой системе используется аллельный обмен посредством гомологичной рекомбинации для замены любой из вставок золотистой сумки Tn.Все обмены устраняют гены устойчивости к эритромицину и gfp мутантов NTML. Флуоресцентные репортерные гены бывают версии «F» и «R», чтобы их можно было правильно выбрать на основе ориентации вставки транспозона. Для получения подробной информации об этой системе, см. , Bose et al. 2013 публикация который подробно описывает эту систему . В таблице ниже вы найдете краткое описание системы со ссылками на карты плазмид и файлы последовательностей плазмид.

Этот набор инструментов доступен через NARSA и включает все обменные плазмиды, перечисленные ниже в S. aureus RN4220 как а также pJB38 (в DH5α), термочувствительная плазмида аллельного обмена, которая является родительской плазмидой плазмиды Toolbox конструкции. pJB38 полезен для хромосомного мутагенеза любого несущественного гена в S. aureus .

Протокол для использования этой системы можно найти здесь

Информация для заказа, карта плазмид и файлы последовательностей ДНК для генетического инструментария NTML доступны в NARSA

Свяжитесь с BEI Resources, чтобы заказать инструменты для использования с NTML (www.beiresources.org)

Microsoft NTLM — приложения Win32

  • 2 минуты на чтение

В этой статье

Windows Challenge / Response (NTLM) — это протокол аутентификации, используемый в сетях, которые включают системы под управлением операционной системы Windows и автономные системы.

Пакет безопасности Microsoft Kerberos обеспечивает большую безопасность, чем NTLM, системам в сети.Хотя Microsoft Kerberos является предпочтительным протоколом, NTLM по-прежнему поддерживается. NTLM также необходимо использовать для аутентификации при входе в автономные системы. Дополнительные сведения о Kerberos см. В разделе Microsoft Kerberos.

Учетные данные

NTLM основаны на данных, полученных в процессе интерактивного входа в систему, и состоят из имени домена, имени пользователя и одностороннего хэша пароля пользователя. NTLM использует зашифрованный протокол запроса / ответа для аутентификации пользователя без отправки пароля пользователя по сети.Вместо этого система, запрашивающая аутентификацию, должна выполнить расчет, подтверждающий, что у нее есть доступ к защищенным учетным данным NTLM.

Интерактивная аутентификация NTLM по сети обычно включает две системы: клиентскую систему, где пользователь запрашивает аутентификацию, и контроллер домена, где хранится информация, относящаяся к паролю пользователя. Неинтерактивная проверка подлинности, которая может потребоваться для разрешения уже вошедшему в систему пользователя для доступа к ресурсу, такому как серверное приложение, обычно включает три системы: клиент, сервер и контроллер домена, который выполняет вычисления проверки подлинности от имени сервера. .

Следующие шаги представляют собой схему неинтерактивной аутентификации NTLM. Первый шаг предоставляет учетные данные NTLM пользователя и выполняется только как часть процесса интерактивной аутентификации (входа в систему).

  1. (только интерактивная проверка подлинности) Пользователь обращается к клиентскому компьютеру и предоставляет имя домена, имя пользователя и пароль. Клиент вычисляет криптографический хэш пароля и отбрасывает фактический пароль.

  2. Клиент отправляет на сервер имя пользователя (в виде открытого текста ).

  3. Сервер генерирует 16-байтовое случайное число, называемое запросом или nonce , и отправляет его клиенту.

  4. Клиент шифрует этот запрос хешем пароля пользователя и возвращает результат серверу. Это называется ответом .

  5. Сервер отправляет контроллеру домена следующие три элемента:

    • Имя пользователя
    • Запрос отправлен клиенту
    • Получен ответ от клиента
  6. Контроллер домена использует имя пользователя для получения хэша пароля пользователя из базы данных Security Account Manager.Он использует этот хэш пароля для шифрования запроса.

  7. Контроллер домена сравнивает зашифрованный запрос, вычисленный им (на шаге 6), с ответом, вычисленным клиентом (на шаге 4). Если они идентичны, аутентификация прошла успешно.

Ваше приложение не должно напрямую обращаться к пакету безопасности NTLM ; вместо этого следует использовать пакет безопасности Negotiate . Negotiate позволяет вашему приложению использовать преимущества более продвинутых протоколов безопасности , если они поддерживаются системами, участвующими в аутентификации.В настоящее время пакет безопасности Negotiate выбирает между Kerberos, и NTLM. Negotiate выбирает Kerberos, если он не может использоваться одной из систем, участвующих в проверке подлинности.

Как должна выглядеть аутентификация NTLM на уровне пакетов?

Введение

Этот документ описывает аутентификацию NT LAN Manager ( NTLM) на уровне пакетов.

Как должна выглядеть аутентификация NTLM на уровне пакетов?

Захват пакетов, чтобы следовать этой статье, можно скачать здесь: https: // supportforums.cisco.com/sites/default/files/attachments/document/ntlm_auth.zip

IP-адрес клиента: 10.122.142.190

WSA IP: 10.122.144.182

Номер пакета и детали

# 4 Клиент отправляет запрос GET на прокси.

# 7 Прокси-сервер отправляет обратно 407. Это означает, что прокси-сервер не разрешает трафик из-за отсутствия надлежащей аутентификации. Если вы посмотрите на заголовки HTTP в этом ответе, вы увидите «Проверка подлинности прокси: NTLM». Это сообщает клиенту, что приемлемым методом аутентификации является NTLM.Аналогичным образом, если присутствует заголовок «Proxy-Authenticate: Basic», прокси сообщает клиенту, что базовые учетные данные приемлемы. Если присутствуют оба заголовка (общие), клиент решает, какой метод аутентификации он будет использовать.

Следует отметить, что заголовок аутентификации — «Proxy-Authenticate:». Это связано с тем, что соединение в захвате использует явный прямой прокси. Если бы это было прозрачное развертывание прокси, код ответа был бы 401 вместо 407, а заголовки были бы «www-authenticate:» вместо «proxy-authenticate:».

# 8 Прокси-сервер FIN определяет этот TCP-сокет. Это правильно и нормально.

# 15 В новом сокете TCP клиент выполняет еще один запрос GET. На этот раз обратите внимание, что GET содержит HTTP-заголовок «proxy-authorization:». Он содержит закодированную строку, которая содержит подробную информацию о пользователе / ​​домене.

Если вы развернете Прокси-авторизация> NTLMSSP, вы увидите декодированную информацию, отправленную в данных NTLM. В «Типе сообщения NTLM» вы заметите, что это «NTLMSSP_NEGOTIATE».Это первый шаг в трехстороннем подтверждении NTLM.

# 17 Прокси-сервер отвечает еще одним 407. Присутствует другой заголовок «proxy-Authenticate». На этот раз он содержит строку запроса NTLM. Если вы развернете его дальше, вы увидите, что тип сообщения NTLM — «NTLMSSP_CHALLENGE». Это второй шаг в трехстороннем подтверждении NTLM.

При проверке подлинности NTLM контроллер домена Windows отправляет клиенту строку запроса. Затем клиент применяет алгоритм к вызову NTLM, который учитывает пароль пользователя в процессе.Это позволяет контроллеру домена проверять, знает ли клиент правильный пароль, даже не посылая пароль по линии. Это намного безопаснее, чем базовые учетные данные, при которых пароль отправляется в виде обычного текста для просмотра всеми устройствами сниффинга.

# 18 Клиент отправляет последнее сообщение GET. Обратите внимание, что этот GET находится на том же сокете TCP, что и NTLM Negotiate и NTLM Challenge. Это жизненно важно для процесса NTLM. Все рукопожатие должно происходить на ЖЕСТКОМ сокете TCP, иначе аутентификация будет недействительной.

В этом запросе клиент отправляет измененный запрос NTLM (ответ NTLM) на прокси. Это последний шаг в трехстороннем рукопожатии NTLM.

# 21 Прокси-сервер отправляет ответ HTTP. Это означает, что прокси-сервер принял учетные данные и решил обслуживать контент.

NTML | Стоимость акций и новости Neto Malinda Trading Ltd.

Акции: котировки акций США в реальном времени отражают сделки, зарегистрированные только через Nasdaq; подробные котировки и объем отражают торговлю на всех рынках и задерживаются не менее чем на 15 минут.Котировки международных акций задерживаются в соответствии с требованиями биржи. Основные данные компании и оценки аналитиков предоставлены FactSet. Авторские права 2019 © FactSet Research Systems Inc. Все права защищены. Источник: FactSet

Индексы: котировки индексов могут быть в режиме реального времени или с задержкой в ​​соответствии с требованиями биржи; обратитесь к отметкам времени для информации о любых задержках. Источник: FactSet

Markets Diary: данные на странице обзора США представляют торговлю на всех рынках США и обновляются до 8 p.м. См. Таблицу «Дневники закрытия» на 16:00. закрытие данных. Источники: FactSet, Dow Jones

.

Таблицы движения акций: Таблицы роста, снижения и наиболее активных участников рынка представляют собой комбинацию списков NYSE, Nasdaq, NYSE American и NYSE Arca. Источники: FactSet, Dow Jones

.

ETF Movers: Включает ETF и ETN с объемом не менее 50 000. Источники: FactSet, Dow Jones

.

Облигации: Котировки облигаций обновляются в режиме реального времени. Источники: FactSet, Tullett Prebon

.

Валюты: Котировки валют обновляются в режиме реального времени.Источники: FactSet, Tullett Prebon

.

Commodities & Futures: цены на фьючерсы задерживаются не менее чем на 10 минут в соответствии с требованиями биржи. Стоимость изменения в течение периода между расчетом открытого протеста и началом торговли на следующий день рассчитывается как разница между последней сделкой и расчетом предыдущего дня. Стоимость изменения в другие периоды рассчитывается как разница между последней сделкой и самым последним расчетом. Источник: FactSet

Данные предоставляются «как есть» только в информационных целях и не предназначены для торговых целей.FactSet (a) не дает никаких явных или подразумеваемых гарантий любого рода в отношении данных, включая, помимо прочего, любые гарантии товарной пригодности или пригодности для определенной цели или использования; и (b) не несет ответственности за любые ошибки, неполноту, прерывание или задержку, действия, предпринятые на основе любых данных, или за любой ущерб, возникший в результате этого. Данные могут быть намеренно задержаны в соответствии с требованиями поставщика.

Паевые инвестиционные фонды и ETF: Вся информация о взаимных фондах и ETF, содержащаяся на этом экране, за исключением текущей цены и истории цен, была предоставлена ​​компанией Lipper, A Refinitiv, при соблюдении следующих условий: Copyright 2019 © Refinitiv.Все права защищены. Любое копирование, переиздание или распространение контента Lipper, в том числе путем кэширования, фреймирования или аналогичных средств, категорически запрещено без предварительного письменного согласия Lipper. Lipper не несет ответственности за какие-либо ошибки или задержки в содержании, а также за любые действия, предпринятые в связи с этим.

Криптовалюты: котировки криптовалют обновляются в режиме реального времени. Источники: CoinDesk (Биткойн), Kraken (все остальные криптовалюты)

Календари и экономика: «Фактические» числа добавляются в таблицу после выпуска экономических отчетов.Источник: Kantar Media

NETO MALINDA (NTML.TA) Цена акций, новости, котировки и история

Тель-Авив — Тель-Авив Цена с задержкой. Валюта в ILA

7,338,00-151,00 (-2,02%)

На момент закрытия: 17:24 IDT

10000,316
Предыдущее закрытие 7,489,00
Открытие 7,621,00
Bid
Ask 7,401,00 x 9300
Дневной диапазон 7,325.00 — 7660,00
52-недельный диапазон 5,041,00 — 7,896,00
Объем 9,273
Ср. Объем 15,750
96 1y Target Est
Рыночная капитализация 1.452B
Бета (5 лет в месяц) 0,24
PE Ratio (TTM)
7,06
Дата прибыли Н / Д
Форвардные дивиденды и доходность Н / Д (Н / Д)
Дата экс-дивидендов 902 902 9 сентября 2019 N / A
  • К сожалению, мы не смогли найти ничего по этой теме.

Откройте для себя новые инвестиционные идеи, получив доступ к объективному и глубокому анализу инвестиций

Neto Malinda Trading Ltd. Цена акций (NTML)

Акции: Котировки акций США в реальном времени отражают сделки, зарегистрированные только через Nasdaq; подробные котировки и объем отражают торговлю на всех рынках и задерживаются не менее чем на 15 минут. Котировки международных акций задерживаются в соответствии с требованиями биржи. Основные данные компании и оценки аналитиков предоставлены FactSet.Copyright 2021 © FactSet Research Systems Inc. Все права защищены. Источник: FactSet

Индексы: Котировки индексов могут быть в режиме реального времени или с задержкой в ​​соответствии с требованиями биржи; обратитесь к отметкам времени для информации о любых задержках. Источник: FactSet

Дневник рынков: Данные на странице обзора США представляют торговлю на всех рынках США и обновляются до 20:00. См. Таблицу «Дневники закрытия» на 16:00. закрытие данных. Источники: FactSet, Dow Jones

Динамика цен на акции: Таблицы роста, снижения и большинства активных участников рынка представляют собой комбинацию списков NYSE, Nasdaq, NYSE American и NYSE Arca.Источники: FactSet, Dow Jones

Двигатели ETF: Включает ETF и ETN с объемом не менее 50 000. Источники: FactSet, Dow Jones

Облигаций: Котировки облигаций обновляются в режиме реального времени. Источники: FactSet, Tullett Prebon

Валюты: Котировки валют обновляются в режиме реального времени. Источники: FactSet, Tullett Prebon

Товары и фьючерсы: Цены на фьючерсы задерживаются не менее чем на 10 минут в соответствии с требованиями биржи.Стоимость изменения в течение периода между расчетом открытого протеста и началом торговли на следующий день рассчитывается как разница между последней сделкой и расчетом предыдущего дня. Стоимость изменения в другие периоды рассчитывается как разница между последней сделкой и самым последним расчетом. Источник: FactSet

Данные предоставляются «как есть» только в информационных целях и не предназначены для торговых целей. FactSet (a) не дает никаких явных или подразумеваемых гарантий любого рода в отношении данных, включая, помимо прочего, любые гарантии товарной пригодности или пригодности для определенной цели или использования; и (b) не несет ответственности за любые ошибки, неполноту, прерывание или задержку, действия, предпринятые на основе любых данных, или за любой ущерб, возникший в результате этого.Данные могут быть намеренно задержаны в соответствии с требованиями поставщика.

Паевые инвестиционные фонды и ETF: Вся информация о взаимных фондах и ETF, содержащаяся на этом экране, за исключением текущей цены и истории цен, была предоставлена ​​компанией Lipper, A Refinitiv Company, при соблюдении следующих условий: Авторские права 2021 © Refinitiv. Все права защищены. Любое копирование, переиздание или распространение контента Lipper, в том числе путем кэширования, фреймирования или аналогичных средств, категорически запрещено без предварительного письменного согласия Lipper.Lipper не несет ответственности за какие-либо ошибки или задержки в содержании, а также за любые действия, предпринятые в связи с этим.

Криптовалюты: Котировки криптовалют обновляются в режиме реального времени. Источники: CoinDesk (Биткойн), Kraken (все другие криптовалюты)

Календари и экономика: «Фактические» числа добавляются в таблицу после публикации экономических отчетов. Источник: Kantar Media

Генетические инструменты для улучшения изучения функции и регуляции генов у Staphylococcus aureus

Appl Environ Microbiol.2013 Apr; 79 (7): 2218–2224.

Центр исследований стафилококков, Отделение патологии и микробиологии, Медицинский центр Университета Небраски, Омаха, Небраска, США

Автор, отвечающий за переписку.

Поступило 14.01.2013 г .; Принято 17 января 2013 г.

Copyright © 2013, Американское общество микробиологии. Все права защищены. Эту статью цитировали в других статьях в PMC.

Abstract

Транспозон bursa aurealis был использован для создания библиотек вставок транспозонов Bacillus anthracis и Staphylococcus aureus .Чтобы предоставить набор генетических инструментов для повышения полезности этих библиотек, мы создали систему аллельного обмена, которая позволяет заменять транспозон полезными генетическими маркерами и флуоресцентными репортерными генами. Эти инструменты были протестированы в Библиотеке мутантов транспозонов штата Небраска (NTML), содержащей определенные вставки транспозонов в 1 952 несущественных генах S. aureus . Во-первых, мы создали плазмиду, которая позволяет исследователям заменять гены, кодирующие зеленый флуоресцентный белок (GFP) и устойчивость к эритромицину в транспозоне, некодирующим фрагментом ДНК, оставляя безмаркерную мутацию в хромосоме.Во-вторых, мы получили плазмиды с аллельным обменом для замены транспозона альтернативными кассетами устойчивости к антибиотикам, кодирующими устойчивость к тетрациклину, канамицину и спектиномицину, что позволило одновременно выбрать несколько хромосомных мутаций. В-третьих, мы создали серию флуоресцентных репортерных конструкций, которые после аллельного обмена генерируют транскрипционные репортеры, кодирующие оптимизированный для кодонов усиленный голубой флуоресцентный белок (ECFP), усиленный желтый флуоресцентный белок (EYFP), DsRed.T3 (DNT) и eqFP650, а также зеленый флуоресцентный белок superfolder green (sGFP). В целом, сочетание NTML с этой системой обмена аллелей обеспечивает беспрецедентный ресурс для изучения S. aureus .

ВВЕДЕНИЕ

Staphylococcus aureus — это универсальный патоген, который может вызывать множество заболеваний, от простых инфекций мягких тканей до опасных для жизни заболеваний, таких как синдром токсического шока, пневмония, абсцессы мозга и эндокардит (1).В последнее время появились штаммы, вызывающие вспышки у здоровых людей за пределами больниц. Эти так называемые устойчивые к метициллину штаммы S. aureus (CA-MRSA), ассоциированные с сообществом, обладают высокой вирулентностью и несут гены, кодирующие устойчивость к нескольким антибиотикам (2–5). Способность этого патогена вызывать такие разнообразные инфекции, вероятно, связана с большим набором факторов вирулентности, которые он производит, включая множество белков клеточной поверхности, которые связываются с различными компонентами матрикса хозяина, секретируемыми токсинами, гидролитическими ферментами и иммуномодуляторами, которые важно установить. инфекции, сопротивляются иммунному ответу и распространяются на соседние ткани (6, 7).Хотя десятилетия исследований отдельных генов вирулентности предоставили огромное количество информации, связанной с функцией конкретных факторов вирулентности при заболевании, мы только начинаем осознавать роль основного метаболизма, поскольку бактерии конкурируют с хозяином за ограниченные ресурсы. Таким образом, предстоит еще много работы, чтобы получить полное представление о патогенных возможностях этого важного патогена и понять сложные взаимодействия и регуляторные процессы, лежащие в основе потенциального заболевания. Эта работа будет иметь важное значение, поскольку мы продолжаем поиск новых терапевтических стратегий для уменьшения воздействия стафилококковых инфекций.

К сожалению, критический процесс исследования стафилококков, специфическое нарушение отдельных генов для изучения их функций, требует много времени и средств, включая создание плазмид, позволяющих гомологичную рекомбинацию в определенных участках хромосомы и приводящую к генерации аллельная замена желаемого гена. В эпоху «омики», когда мы завалены данными и генерируемыми связанными гипотезами, потребность в конкретных генетических мутациях еще больше.Чтобы уменьшить нагрузку на этот процесс, мы создали коллекцию мутантов транспозонов (Tn) bursa aurealis с определенными последовательностями, названную Библиотекой транспозонов Небраски (NTML), в которой 1952 несущественных гена в геноме S. aureus имеют был нарушен (8). Эта библиотека была создана на основе штамма LAC, представителя линии CA-MRSA USA300, на которую приходится 98% всех инфекций кожи и мягких тканей CA-MRSA (9). NTML стал бесплатным ресурсом для научного сообщества через Сеть по устойчивости к противомикробным препаратам Staphylococcus aureus (NARSA; www.narsa.net).

Чтобы улучшить функциональность NTML, а также других библиотек bursa aurealis (8, 10, 11), мы стремились создать систему аллельного обмена, которая позволила бы простой и универсальный обмен транспозонами, вставленными в хромосома S. aureus с множеством полезных селектируемых маркеров и репортерных генов. Например, был создан один набор плазмид, чтобы обеспечить возможность обмена транспозона с тремя разными селектируемыми маркерами, что упростило создание множества определенных мутаций в S.aureus хромосомы. Другой набор плазмид позволяет заменять транспозон генами без промотора, кодирующими флуоресцентные репортерные белки, что позволяет создавать однокопийные репортерные конструкции с любым геном, представленным в библиотеке. В целом, сочетание этих генетических инструментов с обширной коллекцией определенных мутантов транспозонов в NTML значительно улучшит функциональный анализ генома S. aureus .

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы и среды.

Escherichia coli DH5α использовали для клонирования и выращивали в среде Лурия-Бертани с ампициллином (100 мкг мл -1 ) по мере необходимости для отбора. Штаммы S. aureus , использованные в настоящем исследовании, перечислены и выращивались в триптическом соевом бульоне (TSB), если не указано иное. При необходимости для S. aureus , хлорамфеникол (10 мкг мл -1 ), тетрациклин (5 или 0,625 мкг мл -1 ), эритромицин (5 мкг мл -1 ), спектиномицин (1000 мкг мл -1 ) или канамицин (250 или 75 мкг мл -1 ).Реагенты были приобретены у Sigma-Aldrich (Сент-Луис, Миссури), EMD Chemical, Inc. (Гиббстаун, Нью-Джерси) или Becton Dickinson (Sparks, MD).

Таблица 1

Бактериальные штаммы и плазмиды, использованные в этом исследовании

pckA :: ϕΝΣ

pckA :: ϕΝΣ 9046 JEck :: ecfp 9020 9 01 NE1354 09 NE1354 09 NE1354 с заменой tet (M) (Tet r ) 7 ) замена M 21 90 -461 pJB1 3

1 pTnp20 с обратной ориентацией

Штамм или плазмида Соответствующие характеристики a Источник или ссылка
RN4220 Высокая трансформируемость S.aureus 14
JE2 USA300 CA-MRSA штамм LAC без плазмид 8
NE1260 JE2 pckA :: ϕΝΣ Это исследование
NE1260F JE2 pckA :: fp650 Это исследование
NE1260G JE2 pck
NE1260R JE2 pckA :: rfp Это исследование
NE1260RR JE2 pckA :: RFP 9020 9020 9044 в противоположном направлении 9044 Это исследование 9044 в обратном направлении NE1260Y JE2 pckA :: eyfp Это исследование
NE1354 JE2 hla :: ϕΝΣ 8
NE1354K NE1354 с aphA 3 (Kan r ) замена Это исследование
NE1354TnT NE1354 с усеченным Tn Это исследование
NE1354S

6

NE1354S
Это исследование
Плазмиды
pBFP-F pTnT с ecfp в прямом направлении RFP в обратной ориентации Это исследование
pCL10 pET194ts oriV, Chl r Amp r , pBR322 oriV 22
pCN34 Источник apha-3 21
pCN36 pCN36
pCN55 Источник aad9 21
pFP650-F pTnT с fp650 в прямой ориентации pTnT в обратной ориентации Это исследование
pGFP-F pTnT с sgfp в прямой ориентации Это исследование
pGFP-R pTnT с sgfp20 в обратной ориентации Это исследование
pJB33 pCL10 с P xyl / tetO secY570 902 06 Это исследование
pJB38 pJB33 с удаленным сайтом XhoI Это исследование
pJB68 Источник sgfp Лабораторный инвентарь
Это исследование
KOR1 Источник P xyl / tetO secY570 23
pRFP-F rTnpT6 исследование
pRFP-R pTnT с rfp в обратной ориентации Это исследование
pSPC pTnT с aad9 pTnT с 2 pTnT 2 pTnT в этом исследовании (M) Это исследование
pTnT pJB38 с hom логическая ДНК золотистой сумки Это исследование
pYFP-F pTnT с eyfp в прямой ориентации Это исследование
pYFP-R Это исследование

Молекулярно-генетические методы.

Плазмиды

очищали с использованием системы очистки ДНК Wizard Plus SV Minipreps (Promega Corp., Мэдисон, Висконсин). Олигонуклеотиды () были синтезированы Integrated DNA Technologies (Coralville, IA). ДНК-лигаза и рестрикционные ферменты были получены от New England BioLabs (Беверли, Массачусетс). Фрагменты ДНК выделяли с использованием набора DNA Clean and Concentrator-5 (Zymo Research, Orange, CA). ПЦР выполняли с помощью системы Applied Biosystems GeneAmp PCR System 9700 (Life Technologies Corp., Карлсбад, Калифорния) с использованием ДНК-полимеразы KOD (Novagen, Мэдисон, Висконсин).Продукты ПЦР секвенировали в ядре секвенирования ДНК Медицинского центра Университета Небраски, чтобы гарантировать отсутствие непреднамеренных изменений во время генерации плазмид, описанных в настоящем исследовании. Последовательности анализировали с помощью Vector NTI (Invitrogen, Carlsbad, CA).

Таблица 2

Олигонуклеотиды, использованные в этом исследовании

46GAT acGTCTCTAGACGCGTATAACTATATAGGAAC
Олигонуклеотид Последовательность (5’– 3 ‘) a Источник
JTGAT
JBHLA2 CTATCCATAGTAATAACTGTAGCGAAGTCTGGTG Это исследование
JBPCKA1 CTTGGTGCTGTTAATGCAAGTACTGGAAAATATAC Это исследование
JBPCKA2 GCATGCTCATAATATCTTGCATCGGTAAGAG Это исследование
JBTN3 ccgaattcTCTCTAGACACATAGATGGCGTC Это исследование
JBTN15 ccgctagcTTAGCCTGCCATGATGATGATGTACATTGTGTGAG Это исследование
JBTN16 ccgctagcGCCATACCACAGATGTNCCAGcGCCATACCACAGATGTTCC209 Это исследование
JBTN18 gcctaggTGATTAACTTTATAAGGAGGAAAAACATATGGA Это исследование
JBTN19 cgcctaggTTATAAAAACAAATGATGACGACCTTCTGTAC Это исследование
JBTN20 gcctaggTGATTAACTTTATAAGGAGGAAAAACATATGGG Это исследование
JBTN21 cgcctaggTTAACTATGACCTAATTTTGATGGTAAATC Это исследование
JBTN22 ggcctaggTGATTAACTTTATAAGGAGGAAAAACATATGG Это исследование
JBTN23 ggcctaggTTATTTGTATAATTCATCCATACCTAATGTAA Это исследование
JBTN26 ggcctaggTTATTTATATAATTCATCCATACCTAATGTAA Это исследование
JBTN29 gaCCTAGGGGTTTCAAAATCGGCTC Это исследование
JBTN30 ggcCTAGGTACTAAAAC AATTCATCCAGTAAA Это исследование
JBTN31 gaCCTAGGCAAATATGCTCTTACGTGC Это исследование
JBTN32 ggcctagGCACTAAGTTATTTTATTGAACATATATCTTAC Это исследование
JBTN33 gaCCTAGGATCGAATCCCTTCGTGAGCGTC Это исследование
JBTN34 ggcctaggCTAATTGAGAGAAGTTTCTATAGAATTTTTC Это исследование
JBTN37 gcctaggTGATTAACTTTATAAGGAGGAAAAACATATGAG Это исследование
JBTN38 cgcctaggTTATTTGTAGAGCTCATCCATGCCATGTG Это исследование
JBSECY1 GCCGACTGCGCAAAAGACATAATCGATTC Это исследование
JBSECY2 GGGTGATCTAATGATTCAATGATTCAAACC Это исследование

Генерация pTnT.

Антисмысловую экспрессионную кассету secY из pKOR1 амплифицировали с помощью ПЦР с использованием праймеров JBSECY1 и JBSECY2. Полученный фрагмент был переварен с помощью ClaI и клонирован в pCL10, переваренный с помощью SnaBI и ClaI, для создания pJB33. Чтобы облегчить дальнейшее клонирование, сайт XhoI был удален из pJB33 путем первого переваривания XhoI с последующей обработкой Klenow для создания тупых концов и затем самолигированием полученного фрагмента. Продукт лигирования обрабатывали XhoI для удаления любой оставшейся pJB33 перед трансформацией, что приводило к pJB38.Для создания безмаркерной обменной плазмиды pTnT bursa aurealis амплифицировали ~ 525 п.н. 5 ‘и 3′ концов транспозона с использованием пар праймеров JBTN3 / JBTN15 и JBTN16 / JBTN17 соответственно. 5′-концевой продукт ПЦР расщепляли EcoRI-HF и NheI, тогда как 3’-концевой продукт ПЦР расщепляли NheI и SalI-HF. После расщепления продукты ПЦР одновременно лигировали с pJB38, расщепленным EcoRI-HF и SalI-HF, с образованием pTnT ().

Bursa aurealis система замены.Показаны схема и названия плазмид, полученных в ходе настоящего исследования. Все репортеры оптимизированы по кодонам для S. aureus и включают TIR для повышенной экспрессии. Селективные маркеры антибиотиков имеют собственные промоторы и кодируют устойчивость к канамицину (Kan r ), тетрациклину (Tet r ) и спектиномицину (Spc r ). Для pTnT bla кодирует устойчивость к ампициллину в E. coli и содержит cat для устойчивости к хлорамфениколу в S.aureus .

Строительство репортеров.

Флуоресцентные репортерные гены были оптимизированы по кодонам для S. aureus и синтезированы Invitrogen. Синтезированные гены были амплифицированы с помощью ПЦР из предоставленных плазмид с использованием наборов праймеров JBTN18 / JBTN19, JBTN20 / JBTN21, JBTN22 / JBTN23 и JBTN22 / JBTN26 для DsRed.T3 (DNT), eqFP650, усиленного голубого флуоресцентного белка (ECFP650). усиленный желтый флуоресцентный белок (EYFP) соответственно. Ген, кодирующий зеленый флуоресцентный белок суперпапки (sGFP), амплифицировали с помощью ПЦР из pJB68 с использованием праймеров JBTN37 / JBTN38.Все прямые праймеры включали последовательность TIR (12, 13) для обеспечения усиленной трансляции этих генов. Продукты ПЦР расщепляли AvrII и лигировали в pTnT, расщепленный NheI. Продукты лигирования обрабатывали NheI для удаления любого самолигируемого pTnT и трансформировали в E. coli DH5α. Ориентацию вставки определяли с помощью ПЦР с использованием праймера JBTN22, который связывает последовательность TIR всех вставок, и JBTN17, который находится ниже сайта вставки в pTnT. Плазмиды с репортерным геном в той же ориентации, что и Bursa aurealis ermB получили обозначение «F»; те, что в противоположной ориентации, были помечены буквой «R» ().

Конструирование кассет устойчивости к антибиотикам.

Гены, кодирующие устойчивость к антибиотикам, клонировали с их нативными промоторами в pTnT. Ген aphA-3 амплифицировали с помощью ПЦР из pCN34 с использованием праймеров JBTN29 и JBTN30. Впоследствии полученный продукт расщепляли AvrII и лигировали с pTnT, расщепленным NheI. Продукт лигирования расщепляли NheI и трансформировали в E. coli . Аналогичным образом, tet (M) и aad9 были амплифицированы с использованием праймеров JBTN31 / JBTN32 и JBTN33 / JBTN34 соответственно.Продукты расщепляли AvrII и лигировали в pTnT, как описано для aphA-3 . Ориентацию вставки определяли с использованием 5′-праймера для кассеты устойчивости и JBTN17, который связывается ниже сайта вставки. Полученные плазмиды были названы на основе сделанного ими выбора антибиотиков ().

Аллельный обмен.

Хромосомные изменения в S. aureus были сконструированы путем аллельного обмена. Плазмиды были созданы в E.coli и перенесен в высокотрансформируемый рестрикционно-дефицитный штамм S. aureus RN4220 (14). Трансдукцию в производные JE2 проводили с использованием ϕ11, размноженного на плазмидсодержащем RN4220. Трансдуктанты поддерживали при разрешающей репликации температуре 30 ° C для поддержания и подтверждения плазмиды. Для инициации рекомбинации замороженные исходные штаммы, содержащие плазмиду мутагенеза, наносили на триптический соевый агар (TSA) с добавлением 10 мкг хлорамфеникола -1 мл и инкубировали при 44 ° C в течение ночи.Считалось, что большие колонии — это те, которые подверглись единственному событию рекомбинации и были нанесены на TSA с хлорамфениколом для изолированных колоний во второй раз, а затем инкубированы при 44 ° C в течение ночи. Эти единичные рекомбинанты использовали для инокуляции 3 мл TSB и инкубировали при 30 ° C без отбора, чтобы способствовать второму раунду рекомбинации и потере плазмиды. После нескольких дней серийных разведений культуры высевали на TSA с 100 нг ангидротетрациклина -1 мл, и полученные колонии накладывали на реплики только TSA, TSA с эритромицином и TSA с хлорамфениколом для идентификации клеток, подвергшихся второму воздействию. событие рекомбинации и потеря плазмиды.Чувствительные к эритромицину колонии подвергали скринингу с помощью ПЦР для проверки наличия соответствующего аллеля, то есть праймеров JBHLA1 и JBHLA2 для вставок hla и JBPCKA1 и JBPCKA2 для мутантов pckA (). Иногда выявлялись колонии, чувствительные к эритромицину и устойчивые к хлорамфениколу, предположительно из-за того, что произошла рекомбинация, но с некоторым поддержанием плазмиды. В этих колониях отбирали изолированные колонии на TSA и повторно скринировали для идентификации тех, которые потеряли плазмиду.

Активность гемолиза.

Культуры, выращенные в течение ночи в TSB, разбавляли в TSB до оптической плотности 1,0 при 600 нм. Один микролитр клеточной суспензии наносили на TSA, содержащий 5% дефибринированную кровь кролика (Becton Dickinson). Планшеты инкубировали при 37 ° C в течение 24 ч и визуализировали с помощью AlphaImager (Proteinsimple, Санта-Клара, Калифорния).

Анализ экспрессии pckA .

Экспрессия pckA в ответ на глюкозу выполнялась, как описано ранее, с модификацией (15).Штаммы отбирали на выделенные колонии либо на TSA без глюкозы, либо на TSA, содержащем 50 мМ глюкозы, и инкубировали в течение ночи при 37 ° C. Полученные колонии ресуспендировали в фосфатно-солевом буфере (PBS) и флуоресценцию визуализировали с помощью конфокальной микроскопии в центре конфокального лазерного сканирующего микроскопа UNMC с использованием микроскопа Zeiss LSM 710. Изображения были подготовлены с использованием Zen 2011.

Совместное использование ресурсов.

Одной из целей этого проекта было сделать простую и удобную в использовании систему доступной для научного сообщества.Все плазмиды, полученные в настоящем исследовании, доступны через NARSA. Кроме того, протоколы, карты плазмид и данные о последовательностях плазмид доступны по адресу http://app1.unmc.edu/fgx/.

Номера доступа нуклеотидных последовательностей.

Последовательности TIR и гена для синтезированных оптимизированных по кодонам флуоресцентных аллелей были депонированы в GenBank и им присвоены номера доступа {«type»: «entrez-nucleotide», «attrs»: {«text»: «JX486120», «term_id» «:» 40

39 «,» term_text «:» JX486120 «}} JX486120 [DsRED.T3 (DNT)], {«type»: «entrez-нуклеотид», «attrs»: {«text»: «JX486121», «term_id»: «40

87″, «term_text»: «JX486121»}} JX486121 (ECFP ), {«type»: «entrez-нуклеотид», «attrs»: {«text»: «JX486122», «term_id»: «40

92″, «term_text»: «JX486122»}} JX486122 (EYFP) и { «type»: «entrez-нуклеотид», «attrs»: {«text»: «JX402762», «term_id»: «404250429», «term_text»: «JX402762»}} JX402762 (eqFP650).

РЕЗУЛЬТАТЫ

Получение безмаркерной обменной плазмиды.

NTML — это коллекция из 1952 штаммов, в которых большинство несущественных генов в S.aureus были повреждены вставкой транспозона, кодирующего устойчивость к эритромицину (8). Учитывая обычное использование этого маркера устойчивости к антибиотикам, мы стремились создать плазмиду, которая могла бы использоваться для удаления гена устойчивости к эритромицину в любом из мутантов NTML, тем самым облегчая последующие генетические манипуляции с этими мутантными штаммами. В идеале использование этой плазмиды могло бы обрезать транспозон и оставить безмаркерный «шрам», который продолжал бы инактивировать ген, первоначально нарушенный вставленным транспозоном, и было бы полезно для дополнительных раундов мутагенеза на хромосоме.Для этого мы создали плазмиду pTnT (), которая включает соседние (~ 500 п.н.) последовательности ДНК, происходящие от концов транспозона bursa aurealis , термочувствительного происхождения, устойчивости к хлорамфениколу и индуцируемого ангидротетрациклином контрселекции. Кроме того, мы включили сайт узнавания эндонуклеазы рестрикции NheI между областями, производными bursa aurealis . NheI был выбран, потому что выступы, создаваемые этим ферментом, совместимы с выступами после переваривания AvrII, XbaI и SpeI.Эта универсальность облегчает вставку желаемых репортеров или маркеров селекции, поскольку вполне вероятно, что один или несколько из этих ферментов будут отсутствовать в продуктах, которые нужно клонировать в pTnT. После аллельного обмена эта система уменьшает размер bursa aurealis на ~ 2 т.п.н. и удаляет 72% ermB , а также 35% gfp , оставляя полученный штамм зеленого флуоресцентного белка (GFP) также отрицательным. как чувствительный к эритромицину.

Для тестирования этой системы мы использовали pTnT для усечения транспозона, вставленного в ген hla , кодирующий альфа-гемолизин, в мутанте NTML NE1354.В частности, pTnT трансдуцировали в NE1354, и аллельный обмен выполняли, как описано в разделе «Материалы и методы». После второго раунда генетической рекомбинации мутанты были проверены на чувствительность как к хлорамфениколу (pTnT), так и к эритромицину ( bursa aurealis ). Полученный штамм NE1354TnT был подтвержден с помощью ПЦР хромосомного аллеля с использованием праймеров, фланкирующих вставленный транспозон. Как показано на фиг.4, в то время как штамм дикого типа продуцировал полосу размером 0,54 т.п.н., мутант bursa aurealis NE1354 продуцировал 3.Полоса размером 7 т.п.н. из-за вставки транспозона размером 3,2 т.п.н. Напротив, ПЦР-анализ усеченного мутанта NE1354TnT генерировал полосу размером всего 1,6 т.п.н. Как и ожидалось, этот мутант имел дефицит гемолиза на агаре, содержащем кровь кролика (). Эти результаты демонстрируют, что pTnT является полезным инструментом для удаления кодируемой транспозоном детерминанты устойчивости к эритромицину, в то же время оставляя инактивирующую ген инсерционную мутацию в целевом гене.

Bursa aurealis уменьшение размера у мутанта hla :: Tn.Представлены результаты гемолитической активности (вверху) и ПЦР хромосомных аллелей (внизу) JE2 (0,54 kb), hla :: ϕΝΣ мутанта NE1354 (3,7 kb) и замещающего Tn штамма NE1354TnT (1,6 kb).

Обмен маркеров селекции антибиотиков.

Хотя мутации без маркеров полезны для различных целей, часто бывает выгодно иметь возможность ассоциировать мутацию с альтернативными селектируемыми маркерами, например, для исследований, сравнивающих относительную вирулентность мутантов в моделях коинфекции инфекции.Таким образом, мы создали обменные плазмиды, которые будут включать альтернативные маркеры устойчивости к антибиотикам при удалении кассеты устойчивости к эритромицину. Это также позволило бы трансдукцию вставок других транспозонов во вновь созданный замещающий штамм, чтобы генерировать множественные селектируемые мутации на одном фоне. Мы решили клонировать aphA-3 , tet (M) и aad9 для устойчивости к канамицину, тетрациклину и спектиномицину, соответственно, в pTnT, создав плазмиды pKAN, pTET и pSPC ().Эти плазмиды стабильны в S. aureus при выращивании при 30 ° C и придают устойчивость к канамицину (250 мкг мл -1 ), тетрациклину (5 мкг мл -1 ) или спектиномицину (1000 мкг мл — 1 ) на твердой среде как в производных RN4220, так и в JE2.

Чтобы продемонстрировать полезность этих плазмид и проверить уровень устойчивости, которую они обеспечивают после интеграции в хромосому, мы заменили транспозон bursa aurealis в мутанте hla NE1354 каждой из этих кассет устойчивости к антибиотикам и проанализировали устойчивость. полученных штаммов к антибиотикам ().После аллельного обмена полученные штаммы были названы NE1354S, NE1354K и NE1354T на основании замены транспозона кассетами устойчивости к спектиномицину, канамицину и тетрациклину соответственно. Было обнаружено, что NE1354S растет на среде TSA, а также в бульоне TSB при 1000 мкг спектиномицина -1 мл, как и в случае реплицирующейся плазмиды. NE1354K и NE1354T не могли хорошо расти при таких высоких концентрациях антибиотиков, как те, которые использовались для селекции на основе плазмид. Однако было обнаружено, что NE1354K хорошо растет в TSB с добавлением 75 мкг канамицина ml -1 , в то время как родительский штамм NE1354 и JE2 — нет.Аналогичным образом, 0,625 мкг тетрациклина -1 мл в TSB было селективным, позволяя расти только NE1354T. Было подтверждено, что все заменяющие штаммы чувствительны к 5 мкг эритромицина ml -1 , тогда как NE1354 был устойчивым, демонстрируя, что использование этих плазмид с аллельным обменом инактивирует устойчивость к эритромицину, обеспечивая устойчивость к альтернативным антибиотикам. Все полученные мутанты оставались дефектными по продукции альфа-гемолизина, что указывает на то, что ген hla был нарушен в каждом штамме.Основываясь на этих выводах, описанные здесь концентрации должны подходить для выбора во время роста в жидкой среде для этих кассет устойчивости к антибиотикам при размещении на хромосоме.

Рост штаммов с альтернативными маркерами антибиотиков. Оптическая плотность при 600 нм JE2 (черный), hla :: ϕΝΣ мутанта NE1354 (синий) и мутантов с аллельным обменом NE1354K (коричневый), NE1354S (коричневый) и NE1354T (серый), выращенных в 3 мл TSB в пробирках с указанными антибиотиками в течение 15 ч при 37 ° С при встряхивании (250 об / мин).Антибиотики использовали в дозах 5,0, 75, 1000 и 0,625 мкг / мл -1 для эритромицина (Erm), канамицина (Kan), спектиномицина (Spc) и тетрациклина (Tet), соответственно. Значения представляют собой среднее значение ( n = 2) со стандартной ошибкой.

Создание флуоресцентной репортерной системы.

Третьей целью этого проекта было создание серии плазмид, которые позволили бы заменить репортер GFP в bursa aurealis другими вариантами флуоресцентного репортера.Для этого мы клонировали гены, кодирующие DsRed.T3 (DNT) (16), eqFP650 (17), ECFP, sGFP и EYFP, в сайт NheI pTnT. Чтобы максимизировать экспрессию и, следовательно, обнаружение флуоресцентных белков, мы включили оптимизированную область инициации трансляции (TIR). Этот TIR содержит согласованную последовательность Шайна-Дальгарно и область энхансера фага T7 для минимизации вторичной структуры (12, 13). Поскольку bursa aurealis транспозон может интегрироваться в хромосому в двух ориентациях относительно гена, в который он встроен (например,g., «вперед» или «назад» относительно направления прерванного гена), мы сделали две конструкции для каждого флуоресцентного репортера, так что выбор соответствующей плазмиды с аллельным обменом позволит разместить репортер ниже промотора. целевого гена. Для простоты названия плазмид были основаны на репортере, а также на ориентации, в которой он будет интегрировать флуоресцентный репортерный ген в транспозон bursa aurealis . Таким образом, каждая флуоресцентная репортерная плазмида имеет две версии (и), одна из которых обозначена «R», а другая — «F.”В качестве примера вставки транспозонов, которые находятся в обратной ориентации по отношению к поврежденному гену (указанному на веб-сайте NTML [http://app1.unmc.edu/fgx/]), потребуют использования« R »версии плазмида для создания транскрипционного слияния с флуоресцентным репортерным геном.

В качестве иллюстрации функциональности этих репортерных плазмид мы заменили вставку транспозона в гене pckA в мутанте NTML NE1260 на наши гены, кодирующие различные флуоресцентные репортеры. pckA кодирует фосфоенолпируваткарбоксикиназу, и экспрессия этого фермента подавляется в присутствии глюкозы регулятором CcpA (15, 18, 19). Основываясь на этих предыдущих исследованиях, мы ожидали наблюдать флуоресценцию, когда мутанты выращивали в отсутствие глюкозы, без экспрессии в присутствии глюкозы. Чтобы проверить это, мы сначала заменили bursa aurealis в мутанте pckA :: Tn NE1260 на репортер DsRed.T3 (DNT) с использованием pRFP-F. Как видно на фиг., Мы наблюдали глюкозозависимую флуоресценцию DsRed.T3 (DNT) в замещающем штамме NE1260R. Однако, когда ген, кодирующий DsRed.T3 (DNT), был помещен в противоположную ориентацию (NE1260RR) с помощью pRFP-R, флуоресценции не наблюдалось. Точно так же мы смогли продемонстрировать ту же глюкозозависимую экспрессию, когда репортеры sGFP, eqFP650, ECFP и EYFP были использованы для замены транспозона, вставленного в pckA . Репортер ECFP был труднее всего для обнаружения индукции, вероятно, из-за более низкого выхода флуоресценции этого белка, чем других используемых флуоресцентных белков.Эти данные демонстрируют, что эти плазмиды с аллельной заменой могут быть эффективно использованы для конструирования кодируемых хромосомами флуоресцентных репортеров нескольких цветов.

Экспрессия флуоресцентных репортеров. Показаны репрезентативные изображения клеток, выращенных в течение ночи на TSA с 50 мМ глюкозы или без нее, которые были ресуспендированы в PBS и визуализированы с помощью микроскопа Zeiss LSM 710. Масштабная линейка (верхняя правая панель), 5 мкм. ДИК, дифференциальный интерференционный контраст.

ОБСУЖДЕНИЕ

Транспозон bursa aurealis недавно был использован для создания библиотеки мутантных транспозонов с определенной последовательностью (обозначенной NTML) с CA-MRSA USA300 штаммом LAC (8) и свободно доступен для использования исследовательским сообществом.Цели настоящего исследования состояли в том, чтобы предоставить систему замены аллелей (), которая бы дополняла и усиливала возможности NTML. В частности, наши цели были тройными, и все они основывались на создании плазмид, которые могли бы заменить встроенный транспозон посредством гомологичной рекомбинации в любом из мутантов NTML на фрагмент ДНК с расширенной функциональностью.

Первым компонентом этой системы является безмаркерная обменная плазмида, pTnT, которая дает пользователям NTML возможность инактивировать гены gfp и ermB , обнаруженные в золотой бурсе .Это позволяет конструировать мутантные штаммы, в которых отсутствует селектируемый маркер, что облегчает внедрение вторичных мутаций (отмеченных или немаркированных) в другие участки хромосомы. Демонстрация полезности этой плазмиды показана на рисунке, который иллюстрирует замену гена устойчивости к эритромицину, ассоциированного с bursa aurealis , на «рубец» размером ~ 1 т.п.н., в котором отсутствуют какие-либо детерминанты устойчивости, но сохраняется фенотип, дефектный по альфа-токсину. . Включение уникального сайта NheI в pTnT позволяет легко клонировать другие репортеры или маркеры, которые пользователь может разместить на хромосоме.Важно отметить, что эта система обеспечивает почти безграничную гибкость при создании штаммов, содержащих несколько мутаций. Крайне важно провести надлежащий ПЦР-скрининг полученных штаммов, поскольку каждый раунд переноса может приводить к рекомбинации между фрагментами золотистой сумки и .

Во-вторых, мы сконструировали серию плазмид, которая позволяет замену гена устойчивости к эритромицину в bursa aurealis другими селектируемыми маркерами, что позволяет ввести до четырех отмеченных мутаций в один штамм.Было показано, что обмен ассоциированного с hla и транспозона с другими селектируемыми маркерами, такими как те, которые кодируют устойчивость к спектиномицину, канамицину и тетрациклину, придает устойчивость к этим антибиотикам, несмотря на то, что эти гены находятся в единственной копии (). Таким образом, эта система должна быть полезной для выбора комбинаций инсерционных мутаций в хромосоме.

Наконец, мы создали коллекцию плазмид, которые можно использовать для создания слитых конструкций с однокопийными промоторами с использованием пяти различных флуоресцентных белков.Используемые здесь флуоресцентные белки были выбраны потому, что они охватывают диапазон длин волн возбуждения, совместимых со многими эпифлуоресцентными и конфокальными микроскопами; Кроме того, системы проточной цитометрии могут обнаруживать большинство этих флуорофоров. Кроме того, было продемонстрировано, что флуоресцентный белок ближнего инфракрасного диапазона eqFP650 хорошо работает с системами визуализации IVIS (17), что делает этот белок чрезвычайно полезным инструментом для исследователей, заинтересованных в проведении исследований на живых животных для мониторинга инфекций. Более того, универсальность этих флуоресцентных белков позволит исследователям отслеживать экспрессию нескольких промоторов в пределах одной популяции клеток и позволяет сортировать эти популяции с помощью сортировки клеток, активируемой флуоресценцией.Полезности этих репортеров, когда они экспрессируются из хромосомы, способствует наличие оптимизированного для TIR сайта связывания рибосомы (RBS), а также генерация оптимизированных по кодонам стафилококков генов, кодирующих эти белки. Из-за высокой гомологии последовательностей между ecfp , eyfp и нативным gfp в bursa aurealis , мы были обеспокоены возможными нежелательными событиями рекомбинации. Однако нам не удалось обнаружить каких-либо событий рекомбинации во время репликации плазмиды в E.coli или S. aureus , как определено с помощью ПЦР и рестрикционного расщепления эндонуклеазами. Кроме того, мы никогда не идентифицировали какую-либо нежелательную рекомбинацию в наших конечных мутантах, что было определено с помощью нескольких ПЦР. Несмотря на эти результаты, мы предлагаем пользователям этой системы обеспечить надлежащий аллельный обмен путем скрининга мутантов с помощью ПЦР. Кроме того, чтобы гарантировать, что любые фенотипы, связанные с событием обмена аллелей, не являются результатом непредвиденных мутаций вторичного сайта, перенос сконструированных мутаций на чистый фон и исследования комплементации (с использованием плазмид, таких как pLI50 [20], pCN51 [21]). , и pRN8298 [21]).

Целью этого проекта было создание полезного генетического «инструментария», который расширяет возможности библиотек bursa aurealis . Помимо NTML, эта система совместима с ранее созданной библиотекой в ​​ B. anthracis (11) и библиотекой Phoenix в S. aureus Newman (10) и может использоваться с будущими библиотеками bursa aurealis , созданными у других бактерий. В целом, объединение возможностей этих библиотек с этим разнообразным набором инструментов должно значительно расширить возможности изучения функции и регуляции генов в S.aureus и других важных грамположительных возбудителей. БЛАГОДАРНОСТЬ основного объекта. Кроме того, мы благодарим Кари Нельсон за помощь в подготовке рукописи и Алекса Хорсвилла за предоставление sgfp .

Это исследование было поддержано грантом Министерства обороны W911BNF-09-0164 и грантом NIH PO1AI83211 для P.D.F. и К.В.Б.

Сноски

Опубликованы досрочно 25 января 2013 г.

ССЫЛКИ

1. Клевенс Р.М., Моррисон М.А., Надл Дж., Пети С., Гершман К., Рэй С., Харрисон Л.Х., Линфилд Р., Думяти Дж., Таунс Дж. М., Крейг А.С., Зелл Э.Р., Фосхайм Г.Э., Макдугал Л.К., Кэри Р.Б., Фридкин С.К. 2007 г. Инвазивные метициллин-резистентные инфекции Staphylococcus aureus в США.JAMA 298: 1763–1771 [PubMed] [Google Scholar] 2. Могилы SF, Кобаяши SD, DeLeo FR. 2010 г. Связанный с сообществом устойчивый к метициллину Staphylococcus aureus — уклонение от иммунитета и вирулентность. J. Mol. Med. 88: 109–114 [Бесплатная статья PMC] [PubMed] [Google Scholar] 3. Кеннеди А.Д., Порселла С.Ф., Мартенс К., Уитни А.Р., Браутон К.Р., Чен Л., Крейг К.Т., Теновер ФК, Крейсвирт Б.Н., Мюссер Дж.М., ДеЛео Ф.Р. 2010 г. Полный анализ нуклеотидной последовательности плазмид в штаммах Staphylococcus aureus clone USA300 показывает высокий уровень идентичности среди изолятов с близкородственными последовательностями ядра генома.J. Clin. Microbiol. 48: 4504–4511 [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Отто М. 2010 г. Основа вирулентности у метициллинрезистентного золотистого стафилококка, ассоциированного с сообществом. Анну. Rev. Microbiol. 64: 143–162 [PubMed] [Google Scholar] 5. Войич Дж. М., Браутон К. Р., Стердевант Д. Е., Уитни А. Р., Саид-Салим Б., Порселла С.Ф., Лонг Р. Д., Дорвард Д. В., Гарднер Д. Д., Крейсвирт Б. Н., Массер Дж. М., ДеЛео Ф. 2005 г. Понимание механизмов, используемых Staphylococcus aureus для предотвращения разрушения нейтрофилами человека.J. Immunol. 175: 3907–3919 [PubMed] [Google Scholar] 6. Кобаяши SD, DeLeo FR. 2009 г. Обновленная информация о вирулентности MRSA, связанной с сообществами. Curr. Opin. Pharmacol. 9: 545–551 [PubMed] [Google Scholar] 7. Низет В. 2007 г. Понимание того, как ведущие бактериальные патогены подрывают врожденный иммунитет, чтобы выявить новые терапевтические цели. J. Allergy Clin. Иммунол. 120: 13–22. [PubMed] [Google Scholar] 8. Фей П.Д., Эндрес Дж.Л., Яджала В.К., Видхельм Т.Дж., Буасси Р.Дж., Бозе Дж.Л., Бейлс К.В. 2013. Генетический ресурс для быстрого и всестороннего фенотипического скрининга несущественных генов Staphylococcus aureus.мБио 4 (): e00537012 doi: 10.1128 / mBio.00537-12 [Бесплатная статья PMC] [PubMed] [Google Scholar] 9. Талан Д.А., Кришнадасан А., Горвиц Р.Дж., Фосхайм Г.Е., Лимбаго Б., Альбрехт В., Моран Г.Дж. 2011 г. Сравнение золотистого стафилококка от инфекций кожи и мягких тканей у пациентов отделения неотложной помощи США, 2004 и 2008 гг. Clin. Заразить. Дис. 53: 144–149 [PubMed] [Google Scholar] 10. Bae T, Banger AK, Wallace A, Glass EM, Aslund F, Schneewind O, Missiakas DM. 2004 г. Гены вирулентности золотистого стафилококка, идентифицированные мутагенезом золотистой сумки и уничтожением нематод.Proc. Natl. Акад. Sci. США. 101: 12312–12317 [Бесплатная статья PMC] [PubMed] [Google Scholar] 11. Там Ч., Гласс Э.М., Андерсон Д.М., Миссиакас Д. 2006 г. Транспозонный мутагенез штамма Bacillus anthracis Sterne с использованием золотистой сумки. Плазмида 56: 74–77 [PubMed] [Google Scholar] 12. Ченг X, Паттерсон Т.А. 1992 г. Конструирование и использование промоторных векторов лямбда-PL для прямого клонирования и высокого уровня экспрессии кодирующих последовательностей ДНК, амплифицированных ПЦР. Nucleic Acids Res. 20: 4591–4598 [Бесплатная статья PMC] [PubMed] [Google Scholar] 13.Миллер WG, Lindow SE. 1997 г. Усовершенствованная кассета для клонирования GFP, предназначенная для слияния транскрипции прокариот. Ген 191: 149–153 [PubMed] [Google Scholar] 14. Крейсвирт Б.Н., Лофдаль С., Бетли М.Дж., О’Рейли М., Шливерт П.М., Бергдолл М.С., Новик Р.П. 1983 г. Структурный ген экзотоксина синдрома токсического шока не передается профагом. Природа 305: 709–712 [PubMed] [Google Scholar] 15. Сковилл WH, Schreier HJ, Bayles KW. 1996 г. Идентификация и характеристика гена pckA из Staphylococcus aureus.J. Bacteriol. 178: 3362–3364 [Бесплатная статья PMC] [PubMed] [Google Scholar] 16. Данн А.К., Милликен Д.С., Адин Д.М., Бозе Дж.Л., Стабб Э.В. 2006 г. Новые инструменты на основе rfp и pES213 для анализа симбиотических Vibrio fischeri выявляют паттерны инфекции и экспрессии lux in situ. Прил. Environ. Microbiol. 72: 802–810 [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Щербо Д., Шемякина И.И., Рябова А.В., Люкер К.Э., Шмидт Б.Т., Суслова Е.А., Городничева Т.В., Струкова Л., Шидловский К.М., Британова О.В., Зарайский А.Г., Лукьянов К.А., Лощенов В.Б., Лукер Г.Д., Чудаков Д.М.2010 г. Флуоресцентные белки ближнего инфракрасного диапазона. Nat. Методы 7: 827–829 [Бесплатная статья PMC] [PubMed] [Google Scholar] 18. Зайдль К., Мюллер С., Франсуа П., Крибитч С., Шренцель Дж., Энгельманн С., Бишофф М., Бергер-Бачи Б. 2009 г. Влияние импульса глюкозы на регулон CcpA у Staphylococcus aureus. BMC Microbiol. 9: 95 doi: 10.1186 / 1471-2180-9-95 [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Зайдл К., Штуки М., Рюгг М., Гёрке С., Вольц К., Харрис Л., Бергер-Бачи Б., Бишофф М. 2006 г. Staphylococcus aureus CcpA влияет на продукцию детерминант вирулентности и устойчивость к антибиотикам.Противомикробный. Агенты Chemother. 50: 1183–1194 [Бесплатная статья PMC] [PubMed] [Google Scholar] 20. Ли CY, Buranen SL, Ye ZH. 1991 г. Создание однокопийных интеграционных векторов для Staphylococcus aureus. Ген 103: 101–105 [PubMed] [Google Scholar] 21. Шарпантье Э, Антон А.И., Барри П., Альфонсо Б., Фанг Y, Новик Р.П. 2004 г. Новая система челночных векторов на кассетной основе для грамположительных бактерий. Прил. Environ. Microbiol. 70: 6076–6085 [Бесплатная статья PMC] [PubMed] [Google Scholar] 22. Сау С., Сун Дж., Ли Си.1997 г. Молекулярная характеристика и транскрипционный анализ генов капсулы 8 типа у Staphylococcus aureus.